Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACATTCCAGAGCAAACACAGCTCCC[C/T]ATTACTCTATACCAGGCACTGGCAT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604350 MIM: 613771 | ||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
CCDC159 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
CCDC159 - coiled-coil domain containing 159 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001080503.2 | 356 | Intron | NP_001073972.2 | |||
XM_006722643.1 | 356 | Intron | XP_006722706.1 | |||
XM_011527678.2 | 356 | Intron | XP_011525980.2 | |||
XM_017026255.1 | 356 | Intron | XP_016881744.1 | |||
XM_017026256.1 | 356 | Intron | XP_016881745.1 | |||
XM_017026257.1 | 356 | Intron | XP_016881746.1 | |||
XM_017026258.1 | 356 | Intron | XP_016881747.1 | |||
XM_017026259.1 | 356 | Intron | XP_016881748.1 | |||
XM_017026260.1 | 356 | Intron | XP_016881749.1 | |||
XM_017026261.1 | 356 | UTR 5 | XP_016881750.1 | |||
XM_017026262.1 | 356 | Intron | XP_016881751.1 | |||
XM_017026263.1 | 356 | Intron | XP_016881752.1 | |||
XM_017026264.1 | 356 | UTR 5 | XP_016881753.1 |
PLPPR2 - phospholipid phosphatase related 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RAB3D - RAB3D, member RAS oncogene family | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM205 - transmembrane protein 205 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145416.1 | 356 | Intron | NP_001138888.1 | |||
NM_001321112.1 | 356 | Intron | NP_001308041.1 | |||
NM_001321113.1 | 356 | Intron | NP_001308042.1 | |||
NM_001321114.1 | 356 | Intron | NP_001308043.1 | |||
NM_033408.3 | 356 | Intron | NP_212133.1 | |||
NM_198536.2 | 356 | Intron | NP_940938.1 | |||
XM_005259899.2 | 356 | Intron | XP_005259956.1 | |||
XM_017026769.1 | 356 | Intron | XP_016882258.1 |