Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTGAATCGTGGCTGTATCATTTCC[G/T]AGTTGTGAGACCTTGGGCAAGTTCC
Species: |
Human | ||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603248 | ||||||||||||||||||||||||||||||||
Literature Links: |
BMPR1B PubMed Links | ||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | JPT (Japanese)
|
|||
AFR - Not Available | Japanese - Not Available | CHB (Han Chinese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
BMPR1B - bone morphogenetic protein receptor type 1B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001203.2 | Intron | NP_001194.1 | ||||
NM_001256792.1 | Intron | NP_001243721.1 | ||||
NM_001256793.1 | Intron | NP_001243722.1 | ||||
NM_001256794.1 | Intron | NP_001243723.1 | ||||
XM_011532201.2 | Intron | XP_011530503.1 | ||||
XM_017008558.1 | Intron | XP_016864047.1 | ||||
XM_017008559.1 | Intron | XP_016864048.1 | ||||
XM_017008560.1 | Intron | XP_016864049.1 | ||||
XM_017008561.1 | Intron | XP_016864050.1 |
BMPR1B-AS1 - BMPR1B antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |