Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCACCAGAATGTGTTTCTTCCCTG[C/G]GGGTGAGGGGGTCGCTAGCGAGGCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610405 MIM: 610991 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CHPF PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CHPF - chondroitin polymerizing factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3132 - microRNA 3132 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
OBSL1 - obscurin like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001173408.1 | Intron | NP_001166879.1 | ||||
NM_001173431.1 | Intron | NP_001166902.1 | ||||
NM_015311.2 | Intron | NP_056126.1 | ||||
XM_005246424.4 | Intron | XP_005246481.1 | ||||
XM_005246427.4 | Intron | XP_005246484.1 | ||||
XM_011510857.2 | Intron | XP_011509159.1 | ||||
XM_011510863.2 | Intron | XP_011509165.1 | ||||
XM_011510864.2 | Intron | XP_011509166.1 | ||||
XM_011510865.2 | Intron | XP_011509167.1 | ||||
XM_011510866.2 | Intron | XP_011509168.1 | ||||
XM_017003696.1 | Intron | XP_016859185.1 | ||||
XM_017003697.1 | Intron | XP_016859186.1 | ||||
XM_017003698.1 | Intron | XP_016859187.1 | ||||
XM_017003699.1 | Intron | XP_016859188.1 | ||||
XM_017003700.1 | Intron | XP_016859189.1 |
TMEM198 - transmembrane protein 198 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |