Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCCCTGGAGACAGCCCCCCAGGCA[A/G]GGGCCTCACTGACCTTGGAAGAAGA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606839 MIM: 605047 MIM: 611780 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CDHR5 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CDHR5 - cadherin related family member 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IRF7 - interferon regulatory factor 7 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001572.3 | Intron | NP_001563.2 | ||||
NM_004029.2 | Intron | NP_004020.1 | ||||
NM_004031.2 | Intron | NP_004022.2 | ||||
XM_005252906.3 | Intron | XP_005252963.1 | ||||
XM_005252907.3 | Intron | XP_005252964.1 | ||||
XM_005252909.3 | Intron | XP_005252966.1 | ||||
XM_011520066.2 | Intron | XP_011518368.1 | ||||
XM_017017674.1 | Intron | XP_016873163.1 |
PHRF1 - PHD and ring finger domains 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286581.1 | Intron | NP_001273510.1 | ||||
NM_001286582.1 | Intron | NP_001273511.1 | ||||
NM_001286583.1 | Intron | NP_001273512.1 | ||||
NM_020901.3 | Intron | NP_065952.2 | ||||
XM_005253025.4 | Intron | XP_005253082.1 | ||||
XM_005253027.3 | Intron | XP_005253084.1 | ||||
XM_011520236.2 | Intron | XP_011518538.1 | ||||
XM_011520237.2 | Intron | XP_011518539.1 |