Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCACAGCTTCAACATCTCTTCTGGG[C/T]CCTCCTCCTGGTTTGCTCACTCCTC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607359 MIM: 609722 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
C8orf58 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
C8orf58 - chromosome 8 open reading frame 58 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CCAR2 - cell cycle and apoptosis regulator 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_021174.5 | 333 | Silent Mutation | GGC,GGT | G,G 28 | NP_066997.3 | |
XM_011544603.1 | 333 | Silent Mutation | GGC,GGT | G,G 28 | XP_011542905.1 | |
XM_011544604.1 | 333 | Silent Mutation | GGC,GGT | G,G 28 | XP_011542906.1 | |
XM_017013717.1 | 333 | Silent Mutation | GGC,GGT | G,G 28 | XP_016869206.1 |
LOC107986876 - proline-rich proteoglycan 2-like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
XM_017014122.1 | 333 | Intron | XP_016869611.1 |
PDLIM2 - PDZ and LIM domain 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |