Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTTCCTTTTTAAAGTGCCAGTATC[A/G]GTGGGGCAGGAAGGGACTCTCAGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603564 MIM: 610891 MIM: 612865 | ||||||||||||||||||||
Literature Links: |
DPM2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DPM2 - dolichyl-phosphate mannosyltransferase polypeptide 2, regulatory subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM102A - family with sequence similarity 102 member A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001035254.2 | 2768 | UTR 3 | NP_001030331.1 | |||
NM_203305.2 | 2768 | UTR 3 | NP_976050.1 |
PIP5KL1 - phosphatidylinositol-4-phosphate 5-kinase like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |