Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGGTCTTGGATATAATAAGGACTCC[A/C]GAGGAAAAGGCTGGCACTTGGGGGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 601181 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
MIR4265 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
MIR4265 - microRNA 4265 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RANBP2 - RAN binding protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006267.4 | Intron | NP_006258.3 | ||||
XM_005264002.2 | Intron | XP_005264059.1 | ||||
XM_005264003.2 | Intron | XP_005264060.1 | ||||
XM_005264004.2 | Intron | XP_005264061.1 | ||||
XM_005264005.4 | Intron | XP_005264062.1 | ||||
XM_005264007.2 | Intron | XP_005264064.1 | ||||
XM_011511575.2 | Intron | XP_011509877.1 | ||||
XM_011511576.2 | Intron | XP_011509878.1 | ||||
XM_011511578.2 | Intron | XP_011509880.1 | ||||
XM_017004623.1 | Intron | XP_016860112.1 | ||||
XM_017004624.1 | Intron | XP_016860113.1 | ||||
XM_017004625.1 | Intron | XP_016860114.1 |
SH3RF3 - SH3 domain containing ring finger 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001099289.2 | Intron | NP_001092759.1 | ||||
XM_011511109.2 | Intron | XP_011509411.1 | ||||
XM_011511110.2 | Intron | XP_011509412.1 |
SH3RF3-AS1 - SH3RF3 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |