Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGAGAGAAAGCAAGCGTCCTCCCT[C/T]CACTCTCCACCCCTTATCCCTGAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607030 MIM: 606951 | ||||||||||||||||||||
Literature Links: |
GCA PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GCA - grancalcin | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
XM_005246446.2 | Intron | XP_005246503.1 | ||||
XM_006712398.3 | Intron | XP_006712461.1 | ||||
XM_006712400.3 | Intron | XP_006712463.1 | ||||
XM_006712401.3 | Intron | XP_006712464.1 | ||||
XM_011510926.2 | Intron | XP_011509228.1 | ||||
XM_011510927.2 | Intron | XP_011509229.1 | ||||
XM_011510928.2 | Intron | XP_011509230.1 | ||||
XM_017003764.1 | Intron | XP_016859253.1 | ||||
XM_017003765.1 | Intron | XP_016859254.1 | ||||
XM_017003766.1 | Intron | XP_016859255.1 | ||||
XM_017003767.1 | Intron | XP_016859256.1 | ||||
XM_017003768.1 | Intron | XP_016859257.1 | ||||
XM_017003769.1 | Intron | XP_016859258.1 |
IFIH1 - interferon induced with helicase C domain 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |