Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAAGTATTTTTAAACATGACAGCTA[A/C]GAACATTCATCTACAGCAACCTATA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 612215 MIM: 612216 | ||||||||||||||||||||
Literature Links: |
MCMDC2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MCMDC2 - minichromosome maintenance domain containing 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001136160.1 | Intron | NP_001129632.1 | ||||
NM_001136161.1 | Intron | NP_001129633.1 | ||||
NM_173518.4 | Intron | NP_775789.3 | ||||
XM_005251174.2 | Intron | XP_005251231.1 | ||||
XM_006716427.3 | Intron | XP_006716490.1 | ||||
XM_006716429.2 | Intron | XP_006716492.1 | ||||
XM_006716433.3 | Intron | XP_006716496.1 | ||||
XM_011517467.2 | Intron | XP_011515769.1 | ||||
XM_011517468.2 | Intron | XP_011515770.1 | ||||
XM_011517469.2 | Intron | XP_011515771.1 | ||||
XM_017013140.1 | Intron | XP_016868629.1 |
SNHG6 - small nucleolar RNA host gene 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD87 - small nucleolar RNA, C/D box 87 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |