Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCCGCCCTCTCAGTCCCGCAGCCA[C/T]GAGGAGGACGCTGCCCAGACTCACT
Species: |
Human | ||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||||||||||||||
Literature Links: |
DSTNP2 PubMed Links | ||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian
|
CEPH (CEU) - Not Available | |||
EAS - Not Available | African American
|
YRI (Yoruba) - Not Available | |||
SAS - Not Available | Japanese
|
CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Chinese
|
JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
DSTNP2 - destrin, actin depolymerizing factor pseudogene 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105369632 - uncharacterized LOC105369632 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL13P5 - ribosomal protein L13 pseudogene 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |