Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTCCTCTCTCCCCTCCAAAGGGCT[C/T]ATGAGAAATAAGAAAGCTAAAAGCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603843 MIM: 603624 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
NDUFB10 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
NDUFB10 - NADH:ubiquinone oxidoreductase subunit B10 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004548.2 | Intron | NP_004539.1 |
RNF151 - ring finger protein 151 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPL3L - ribosomal protein L3 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPS2 - ribosomal protein S2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002952.3 | Intron | NP_002943.2 |
SNHG9 - small nucleolar RNA host gene 9 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA10 - small nucleolar RNA, H/ACA box 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA64 - small nucleolar RNA, H/ACA box 64 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA78 - small nucleolar RNA, H/ACA box 78 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |