Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGATGGGAGAAAAGGTTCTCTGAGA[A/G]CGTATTACATAAGTATCACATGAAC
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 182100 MIM: 610349 | |||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
FUT2 PubMed Links | |||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese)
|
||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
FUT2 - fucosyltransferase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000511.5 | 2686 | Intron | NP_000502.4 | |||
NM_001097638.2 | 2686 | Intron | NP_001091107.1 |
LOC105447645 - uncharacterized LOC105447645 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAMSTR - MEF2 activating motif and SAP domain containing transcriptional regulator | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001130915.1 | 2686 | Intron | NP_001124387.1 | |||
NM_001297753.1 | 2686 | Intron | NP_001284682.1 | |||
NM_182574.2 | 2686 | Intron | NP_872380.1 | |||
XM_011526807.2 | 2686 | Intron | XP_011525109.1 | |||
XM_011526808.2 | 2686 | Intron | XP_011525110.1 | |||
XM_011526809.2 | 2686 | Intron | XP_011525111.1 | |||
XM_017026640.1 | 2686 | Intron | XP_016882129.1 | |||
XM_017026641.1 | 2686 | Intron | XP_016882130.1 | |||
XM_017026642.1 | 2686 | UTR 3 | XP_016882131.1 | |||
XM_017026643.1 | 2686 | Intron | XP_016882132.1 | |||
XM_017026644.1 | 2686 | Intron | XP_016882133.1 | |||
XM_017026645.1 | 2686 | Intron | XP_016882134.1 |
Set Membership: |
HapMap |