Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTACCTAATAGGTTTGTCTAAAGTA[A/G]GGGCATTCCTATGATGGGTTGGTAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615902 | ||||||||||||||||||||
Literature Links: |
FAM177A1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM177A1 - family with sequence similarity 177 member A1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101927178 - uncharacterized LOC101927178 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPP2R3C - protein phosphatase 2 regulatory subunit B''gamma | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001305155.1 | Intron | NP_001292084.1 | ||||
NM_001305156.1 | Intron | NP_001292085.1 | ||||
NM_017917.3 | Intron | NP_060387.2 | ||||
XM_005267782.3 | Intron | XP_005267839.1 | ||||
XM_017021388.1 | Intron | XP_016876877.1 | ||||
XM_017021389.1 | Intron | XP_016876878.1 |