Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACAAAATGGCCCCAGCGTCAGCCCC[A/G]ACCCTAGACCCCTCAGTTGCAGCTC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607375 MIM: 600796 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DOT1L PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DOT1L - DOT1 like histone lysine methyltransferase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032482.2 | 7746 | UTR 3 | NP_115871.1 | |||
XM_005259659.3 | 7746 | UTR 3 | XP_005259716.1 | |||
XM_005259660.3 | 7746 | UTR 3 | XP_005259717.1 | |||
XM_011528359.2 | 7746 | UTR 3 | XP_011526661.1 | |||
XM_011528360.1 | 7746 | UTR 3 | XP_011526662.1 | |||
XM_011528361.2 | 7746 | UTR 3 | XP_011526663.1 | |||
XM_017027366.1 | 7746 | UTR 3 | XP_016882855.1 |
LOC105372239 - uncharacterized LOC105372239 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR1227 - microRNA 1227 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR6789 - microRNA 6789 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PLEKHJ1 - pleckstrin homology domain containing J1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001300836.1 | 7746 | Intron | NP_001287765.1 | |||
NM_018049.2 | 7746 | Intron | NP_060519.1 | |||
XM_017026924.1 | 7746 | Intron | XP_016882413.1 | |||
XM_017026925.1 | 7746 | Intron | XP_016882414.1 | |||
XM_017026926.1 | 7746 | Intron | XP_016882415.1 | |||
XM_017026927.1 | 7746 | Intron | XP_016882416.1 | |||
XM_017026928.1 | 7746 | Intron | XP_016882417.1 |
SF3A2 - splicing factor 3a subunit 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |