Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCTTTGTGTGCGGAGCTGAGCCTT[C/G]AAGGCAGGTTCCGCGGGGGGGGTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609855 MIM: 109684 MIM: 609701 | ||||||||||||||||||||
Literature Links: |
COASY PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
COASY - Coenzyme A synthase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HSD17B1 - hydroxysteroid 17-beta dehydrogenase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000413.2 | Intron | NP_000404.2 | ||||
XM_005257292.3 | Intron | XP_005257349.1 | ||||
XM_006721857.3 | Intron | XP_006721920.1 | ||||
XM_006721858.3 | Intron | XP_006721921.1 | ||||
XM_006721859.3 | Intron | XP_006721922.1 | ||||
XM_011524729.1 | Intron | XP_011523031.1 | ||||
XM_011524730.1 | Intron | XP_011523032.1 | ||||
XM_011524731.1 | Intron | XP_011523033.1 | ||||
XM_011524732.2 | Intron | XP_011523034.1 |
NAGLU - N-acetyl-alpha-glucosaminidase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |