Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGTGGTTACTTCTATTTCACAGAGA[C/T]GTCTGACTTCCTGCAGCAGAATGAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604965 MIM: 616049 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
PABPC1L PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
PABPC1L - poly(A) binding protein cytoplasmic 1 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STK4 - serine/threonine kinase 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006282.3 | Intron | NP_006273.1 | ||||
XM_005260530.2 | Intron | XP_005260587.1 | ||||
XM_005260531.3 | Intron | XP_005260588.1 | ||||
XM_005260532.3 | Intron | XP_005260589.1 | ||||
XM_005260533.2 | Intron | XP_005260590.1 | ||||
XM_011529018.2 | Intron | XP_011527320.1 | ||||
XM_011529020.2 | Intron | XP_011527322.1 | ||||
XM_017028029.1 | Intron | XP_016883518.1 | ||||
XM_017028030.1 | Intron | XP_016883519.1 | ||||
XM_017028031.1 | Intron | XP_016883520.1 | ||||
XM_017028032.1 | Intron | XP_016883521.1 | ||||
XM_017028033.1 | Intron | XP_016883522.1 |
STK4-AS1 - STK4 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TOMM34 - translocase of outer mitochondrial membrane 34 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |