Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGAACAAAGAGAAGGGCATTCCAA[A/G]AAGAGGGAACAGCAAGTGCAAAGGC
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 604644 MIM: 124097 | |||||||||||||||||||||||
Literature Links: |
CA11 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
CA11 - carbonic anhydrase 11 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001217.4 | Intron | NP_001208.2 |
DBP - D-box binding PAR bZIP transcription factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SEC1P - secretory blood group 1, pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |