Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGAGGCGGAAGGGCATCAGGCGGC[A/G]GAAGGTGCCGGGAGAGTAGGGAATC
Species: |
Human | ||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608186 MIM: 182307 | ||||||||||||||||||||||||||||||||
Literature Links: |
EXOC3 PubMed Links | ||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU)
|
|||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | JPT (Japanese)
|
|||
AFR - Not Available | Japanese - Not Available | CHB (Han Chinese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
EXOC3 - exocyst complex component 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100288152 - uncharacterized LOC100288152 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PP7080 - uncharacterized LOC25845 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC9A3 - solute carrier family 9 member A3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001284351.2 | 2507 | Missense Mutation | NP_001271280.1 | |||
NM_004174.3 | 2507 | Missense Mutation | NP_004165.2 |
Set Membership: |
HapMap |