Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCAGGATGGGAACCACGGACTGAC[C/G]TGACCTGCGTCCTCGGGGCCACTGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603267 | ||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
CAPN15 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian
|
CEPH (CEU) - Not Available | ||||||
EAS
|
African American
|
YRI (Yoruba) - Not Available | ||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
CAPN15 - calpain 15 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005632.2 | 321 | UTR 5 | NP_005623.1 | |||
XM_011522620.2 | 321 | UTR 5 | XP_011520922.1 | |||
XM_011522621.2 | 321 | UTR 5 | XP_011520923.1 | |||
XM_011522622.1 | 321 | Intron | XP_011520924.1 | |||
XM_011522623.2 | 321 | UTR 5 | XP_011520925.1 | |||
XM_011522624.2 | 321 | UTR 5 | XP_011520926.1 | |||
XM_011522625.2 | 321 | Intron | XP_011520927.1 | |||
XM_011522626.2 | 321 | UTR 5 | XP_011520928.1 | |||
XM_011522627.2 | 321 | UTR 5 | XP_011520929.1 | |||
XM_011522628.2 | 321 | UTR 5 | XP_011520930.1 | |||
XM_011522629.2 | 321 | UTR 5 | XP_011520931.1 | |||
XM_011522630.2 | 321 | UTR 5 | XP_011520932.1 | |||
XM_011522631.2 | 321 | Intron | XP_011520933.1 | |||
XM_011522632.2 | 321 | Intron | XP_011520934.1 | |||
XM_017023596.1 | 321 | UTR 5 | XP_016879085.1 |
LINC00235 - long intergenic non-protein coding RNA 235 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR3176 - microRNA 3176 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR5587 - microRNA 5587 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
Validated |