Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTGGACAAAAGGATTCCACACCTG[C/T]CACAGGCGCTGCCCCACTCCCTGAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616888 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
LINC00950 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
LINC00950 - long intergenic non-protein coding RNA 950 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
OR13J1 - olfactory receptor family 13 subfamily J member 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM8B - transmembrane protein 8B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001042589.2 | 8050 | Intron | NP_001036054.1 | |||
NM_001042590.2 | 8050 | Intron | NP_001036055.1 | |||
NM_016446.3 | 8050 | Intron | NP_057530.2 | |||
XM_005251483.4 | 8050 | Intron | XP_005251540.3 | |||
XM_011517901.2 | 8050 | Intron | XP_011516203.1 | |||
XM_011517902.2 | 8050 | Intron | XP_011516204.1 | |||
XM_011517903.2 | 8050 | Intron | XP_011516205.1 | |||
XM_011517904.2 | 8050 | Intron | XP_011516206.1 | |||
XM_011517905.1 | 8050 | Intron | XP_011516207.1 | |||
XM_011517908.2 | 8050 | Intron | XP_011516210.1 | |||
XM_011517910.2 | 8050 | Intron | XP_011516212.1 | |||
XM_011517911.2 | 8050 | Intron | XP_011516213.1 | |||
XM_011517912.2 | 8050 | Intron | XP_011516214.1 | |||
XM_011517913.2 | 8050 | Intron | XP_011516215.1 | |||
XM_011517914.2 | 8050 | Intron | XP_011516216.1 | |||
XM_011517915.2 | 8050 | Intron | XP_011516217.1 | |||
XM_011517916.2 | 8050 | UTR 3 | XP_011516218.1 | |||
XM_011517918.2 | 8050 | Intron | XP_011516220.1 | |||
XM_017014805.1 | 8050 | Intron | XP_016870294.1 | |||
XM_017014806.1 | 8050 | Intron | XP_016870295.1 | |||
XM_017014807.1 | 8050 | Intron | XP_016870296.1 |
Set Membership: |
HapMap |