Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCTCTGAACCTTAGTAACTGCAACT[A/G]TAAAATGGGACAGTAATACAGATTA
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 607280 MIM: 147851 | |||||||||||||||||||||||
Literature Links: |
CNTN4 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
CNTN4 - contactin 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CNTN4-AS1 - CNTN4 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IL5RA - interleukin 5 receptor subunit alpha | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000564.4 | 3222 | UTR 3 | NP_000555.2 | |||
NM_001243099.1 | 3222 | UTR 3 | NP_001230028.1 | |||
NM_175724.2 | 3222 | Intron | NP_783851.1 | |||
NM_175725.2 | 3222 | Intron | NP_783852.1 | |||
NM_175726.3 | 3222 | UTR 3 | NP_783853.1 | |||
NM_175727.2 | 3222 | Intron | NP_783854.1 | |||
NM_175728.2 | 3222 | Intron | NP_783855.1 | |||
XM_011533677.2 | 3222 | UTR 3 | XP_011531979.1 | |||
XM_011533678.2 | 3222 | UTR 3 | XP_011531980.1 |