Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAATCCCTTACTTGTCTACATTAA[C/T]CTGCTTTCCTCTGCATCCACACTGG
Species: |
Human | |||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||
Phenotype: |
MIM: 608116 MIM: 615340 | |||||||||||||||||||||||
Literature Links: |
CCDC13 PubMed Links | |||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
CCDC13 - coiled-coil domain containing 13 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HHATL - hedgehog acyltransferase-like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020707.3 | Intron | NP_065758.3 | ||||
XM_006713274.2 | Intron | XP_006713337.1 | ||||
XM_006713275.2 | Intron | XP_006713338.1 | ||||
XM_011533969.2 | Intron | XP_011532271.1 | ||||
XM_011533970.2 | Intron | XP_011532272.1 | ||||
XM_017006935.1 | Intron | XP_016862424.1 | ||||
XM_017006936.1 | Intron | XP_016862425.1 | ||||
XM_017006937.1 | Intron | XP_016862426.1 | ||||
XM_017006938.1 | Intron | XP_016862427.1 |
KLHL40 - kelch like family member 40 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |