Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGAAGGCGCACCCCCCCAGCAATC[C/T]GCGCGCCGGGACAGAATGCCCTGCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
76 submissions
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609130 MIM: 602784 MIM: 601882 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
APITD1 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
APITD1 - apoptosis-inducing, TAF9-like domain 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
APITD1-CORT - APITD1-CORT readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001243768.1 | 760 | Silent Mutation | TCC,TCT | S,S 123 | NP_001230697.1 | |
NM_001270517.1 | 760 | UTR 3 | NP_001257446.1 | |||
NM_198544.3 | 760 | Silent Mutation | TCC,TCT | S,S 144 | NP_940946.1 | |
NM_199006.2 | 760 | UTR 3 | NP_950171.2 |
CORT - cortistatin | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001302.4 | 760 | Silent Mutation | TCC,TCT | S,S 85 | NP_001293.3 |
DFFA - DNA fragmentation factor subunit alpha | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap JSNP |