Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCAGGTCCTCCCCATCAGAGGCCT[C/T]TGTCCTTTGGAAGATCACTCCTGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 602622 MIM: 603022 MIM: 600305 | ||||||||||||||||||||
Literature Links: |
DNASE1L2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
DNASE1L2 - deoxyribonuclease I-like 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
E4F1 - E4F transcription factor 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001288776.1 | Intron | NP_001275705.1 | ||||
NM_001288778.1 | Intron | NP_001275707.1 | ||||
NM_004424.4 | Intron | NP_004415.3 | ||||
XM_005255155.1 | Intron | XP_005255212.1 | ||||
XM_005255156.1 | Intron | XP_005255213.1 | ||||
XM_006720858.1 | Intron | XP_006720921.1 | ||||
XM_011522402.1 | Intron | XP_011520704.1 | ||||
XM_011522403.1 | Intron | XP_011520705.1 | ||||
XM_017023010.1 | Intron | XP_016878499.1 | ||||
XM_017023011.1 | Intron | XP_016878500.1 |
ECI1 - enoyl-CoA delta isomerase 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |