Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATTCCTACTGCCAGCAAAAATATGT[A/G]AAGTGTTTTTATCATTATAAATGAA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 615810 MIM: 612823 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
C11orf54 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
C11orf54 - chromosome 11 open reading frame 54 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286067.1 | 1566 | Intron | NP_001272996.1 | |||
NM_001286068.1 | 1566 | Intron | NP_001272997.1 | |||
NM_001286069.1 | 1566 | Intron | NP_001272998.1 | |||
NM_001286070.1 | 1566 | Intron | NP_001272999.1 | |||
NM_001286071.1 | 1566 | Intron | NP_001273000.1 | |||
NM_014039.3 | 1566 | Intron | NP_054758.2 | |||
XM_006718824.1 | 1566 | Intron | XP_006718887.1 | |||
XM_011542781.2 | 1566 | Intron | XP_011541083.1 | |||
XM_011542782.2 | 1566 | Intron | XP_011541084.1 | |||
XM_017017613.1 | 1566 | UTR 5 | XP_016873102.1 | |||
XM_017017614.1 | 1566 | Intron | XP_016873103.1 | |||
XM_017017615.1 | 1566 | Intron | XP_016873104.1 | |||
XM_017017616.1 | 1566 | Intron | XP_016873105.1 | |||
XM_017017617.1 | 1566 | Intron | XP_016873106.1 | |||
XM_017017618.1 | 1566 | Intron | XP_016873107.1 | |||
XM_017017619.1 | 1566 | Intron | XP_016873108.1 |
SNORA40 - small nucleolar RNA, H/ACA box 40 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAF1D - TATA-box binding protein associated factor, RNA polymerase I subunit D | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |