Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAAAAAATATGTGGACCTTAAGACA[A/G]TCTCTGTTAATGTGGGTTTGGAACA
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
32 submissions
|
|||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616262 MIM: 606225 MIM: 165270 | |||||||||||||||||||||||||||||||||||||||||
Literature Links: |
KLHL21 PubMed Links | |||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
KLHL21 - kelch like family member 21 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TAS1R1 - taste 1 receptor member 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZBTB48 - zinc finger and BTB domain containing 48 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001278647.1 | Intron | NP_001265576.1 | ||||
NM_001278648.1 | Intron | NP_001265577.1 | ||||
NM_005341.3 | Intron | NP_005332.1 | ||||
XM_017001110.1 | Intron | XP_016856599.1 | ||||
XM_017001111.1 | Intron | XP_016856600.1 | ||||
XM_017001112.1 | Intron | XP_016856601.1 | ||||
XM_017001113.1 | Intron | XP_016856602.1 | ||||
XM_017001114.1 | Intron | XP_016856603.1 |
Set Membership: |
HapMap |