Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGCAGAGCCCCGTGGTCGGCACTT[C/T]GTAGGTGGTAGCCAGGACCCTTGTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610164 MIM: 610959 MIM: 610960 MIM: 610961 MIM: 610983 MIM: 615385 MIM: 615037 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
MIR1185-1 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
MIR1185-1 - microRNA 1185-1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR1185-2 - microRNA 1185-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR134 - microRNA 134 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR300 - microRNA 300 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR323B - microRNA 323b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR376A1 - microRNA 376a-1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR376A2 - microRNA 376a-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR376B - microRNA 376b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR376C - microRNA 376c | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR381 - microRNA 381 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR381HG - MIR381 host gene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR382 - microRNA 382 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR485 - microRNA 485 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR487A - microRNA 487a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR487B - microRNA 487b | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR539 - microRNA 539 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR544A - microRNA 544a | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR654 - microRNA 654 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR655 - microRNA 655 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR668 - microRNA 668 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR889 - microRNA 889 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |