Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATCACCTGCCGGGGGTGGGAAGCA[C/G]AGGCTGGGGACAGGTGCATGCCAGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606158 | ||||||||||||||||||||
Literature Links: |
BSCL2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
BSCL2 - BSCL2, seipin lipid droplet biogenesis associated | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001122955.3 | Intron | NP_001116427.1 | ||||
NM_001130702.2 | Intron | NP_001124174.2 | ||||
NM_032667.6 | Intron | NP_116056.3 |
HNRNPUL2-BSCL2 - HNRNPUL2-BSCL2 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRRN4CL - LRRN4 C-terminal like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |