Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCTACACTGAGACGTGTCAGGGAC[A/G]GGTGTATCCGGGGAGAAGGGCGCAG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
37 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 601328 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ACAP3 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ACAP3 - ArfGAP with coiled-coil, ankyrin repeat and PH domains 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCNN1D - sodium channel epithelial 1 delta subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001130413.3 | Intron | NP_001123885.2 | ||||
XM_011541899.2 | Intron | XP_011540201.1 | ||||
XM_011541901.2 | Intron | XP_011540203.1 | ||||
XM_011541902.2 | Intron | XP_011540204.1 | ||||
XM_011541905.2 | Intron | XP_011540207.1 | ||||
XM_011541906.2 | Intron | XP_011540208.1 | ||||
XM_011541908.2 | Intron | XP_011540210.1 | ||||
XM_011541920.2 | Intron | XP_011540222.1 | ||||
XM_011541925.2 | Intron | XP_011540227.1 | ||||
XM_011541929.2 | Intron | XP_011540231.1 | ||||
XM_011541932.2 | Intron | XP_011540234.1 | ||||
XM_011541933.2 | Intron | XP_011540235.1 | ||||
XM_017002037.1 | Intron | XP_016857526.1 | ||||
XM_017002038.1 | Intron | XP_016857527.1 | ||||
XM_017002039.1 | Intron | XP_016857528.1 | ||||
XM_017002040.1 | Intron | XP_016857529.1 | ||||
XM_017002041.1 | Intron | XP_016857530.1 | ||||
XM_017002042.1 | Intron | XP_016857531.1 | ||||
XM_017002043.1 | Intron | XP_016857532.1 | ||||
XM_017002044.1 | Intron | XP_016857533.1 |