Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATTGGGAAAAAACCTTCATATTCAA[C/T]GGTGGATGTCCTGGGGGTTAATTTC
Species: |
Human | |||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||
Phenotype: |
MIM: 604038 MIM: 602725 MIM: 601281 | |||||||||||||||||||||||||||||
Literature Links: |
HYAL3 PubMed Links | |||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS - Not Available | Japanese
|
CHB (Han Chinese) - Not Available | |||
AFR - Not Available | Chinese
|
JPT (Japanese) - Not Available | |||
EUR - Not Available | |||||
AMR - Not Available |
HYAL3 - hyaluronoglucosaminidase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
IFRD2 - interferon related developmental regulator 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LSMEM2 - leucine rich single-pass membrane protein 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001304385.1 | Intron | NP_001291314.1 | ||||
NM_153215.2 | Intron | NP_694947.1 | ||||
XM_006712979.3 | Intron | XP_006713042.1 | ||||
XM_006712980.3 | Intron | XP_006713043.1 | ||||
XM_011533370.2 | Intron | XP_011531672.1 |
SEMA3B - semaphorin 3B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |