Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACAATCAATTTCTATAAACATTGCA[G/T]CTAACTGTGCACTGATCAACTGCAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 152390 MIM: 613335 | ||||||||||||||||||||
Literature Links: |
ALOX5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ALOX5 - arachidonate 5-lipoxygenase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC102724323 - uncharacterized LOC102724323 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MARCH8 - membrane associated ring-CH-type finger 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001002266.2 | 5873 | UTR 3 | NP_001002266.1 | |||
NM_001282866.1 | 5873 | UTR 3 | NP_001269795.1 | |||
NM_145021.5 | 5873 | UTR 3 | NP_659458.2 | |||
XM_005271804.2 | 5873 | UTR 3 | XP_005271861.1 | |||
XM_006717704.2 | 5873 | UTR 3 | XP_006717767.1 | |||
XM_011539492.2 | 5873 | UTR 3 | XP_011537794.1 | |||
XM_011539493.2 | 5873 | UTR 3 | XP_011537795.1 | |||
XM_011539494.2 | 5873 | UTR 3 | XP_011537796.1 | |||
XM_011539495.1 | 5873 | UTR 3 | XP_011537797.1 | |||
XM_017015894.1 | 5873 | UTR 3 | XP_016871383.1 |