Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTCGGAGCCTCTGCTTCCCCGCCCC[C/G]CTTCCCCAGCTTTCTTCTCCCTCCC
Species: |
Human | |||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||
Phenotype: |
MIM: 600534 | |||||||||||||||||||||||||||||
Literature Links: |
BISPR PubMed Links | |||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS - Not Available | African American - Not Available | YRI (Yoruba)
|
|||
SAS - Not Available | Chinese - Not Available | JPT (Japanese)
|
|||
AFR - Not Available | Japanese - Not Available | CHB (Han Chinese)
|
|||
EUR - Not Available | |||||
AMR - Not Available |
BISPR - BST2 interferon stimulated positive regulator (non-protein coding) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
BST2 - bone marrow stromal cell antigen 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004335.3 | Intron | NP_004326.1 |
LOC105372343 - uncharacterized LOC105372343 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MVB12A - multivesicular body subunit 12A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |