Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCACCTCCTTGGGAGACTCTGCGCT[A/T]CTAGCCTTCTGCATACTTTGCGGAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610701 | ||||||||||||||||||||
Literature Links: |
C10orf82 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C10orf82 - chromosome 10 open reading frame 82 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_144661.2 | 1179 | UTR 3 | NP_653262.1 | |||
XM_011539340.2 | 1179 | Intron | XP_011537642.1 | |||
XM_011539341.1 | 1179 | Intron | XP_011537643.1 | |||
XM_011539342.2 | 1179 | Intron | XP_011537644.1 | |||
XM_011539343.2 | 1179 | Intron | XP_011537645.1 | |||
XM_011539344.2 | 1179 | UTR 3 | XP_011537646.1 | |||
XM_011539345.2 | 1179 | UTR 3 | XP_011537647.1 | |||
XM_011539346.2 | 1179 | UTR 3 | XP_011537648.1 | |||
XM_011539347.2 | 1179 | UTR 3 | XP_011537649.1 | |||
XM_017015753.1 | 1179 | UTR 3 | XP_016871242.1 | |||
XM_017015754.1 | 1179 | UTR 3 | XP_016871243.1 | |||
XM_017015755.1 | 1179 | UTR 3 | XP_016871244.1 |
HSPA12A - heat shock protein family A (Hsp70) member 12A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC105378499 - uncharacterized LOC105378499 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |