Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GAGAAGCCTCCAACCAAGGCACTAC[G/T]GAGCGTGGGGTTGGGAGGGACTCTG
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 603781 | |||||||||||||||||||||||||||||||||||||||||
Literature Links: |
MYO15B PubMed Links | |||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | ||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
MYO15B - myosin XVB | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RECQL5 - RecQ like helicase 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001003715.3 | Intron | NP_001003715.1 | ||||
NM_001003716.3 | Intron | NP_001003716.1 | ||||
NM_004259.6 | Intron | NP_004250.4 | ||||
XM_005257818.3 | Intron | XP_005257875.1 | ||||
XM_005257822.3 | Intron | XP_005257879.1 | ||||
XM_005257823.3 | Intron | XP_005257880.1 | ||||
XM_006722186.2 | Intron | XP_006722249.1 | ||||
XM_011525482.2 | Intron | XP_011523784.1 | ||||
XM_011525484.1 | Intron | XP_011523786.1 | ||||
XM_011525485.2 | Intron | XP_011523787.1 | ||||
XM_011525486.2 | Intron | XP_011523788.1 | ||||
XM_017025343.1 | Intron | XP_016880832.1 | ||||
XM_017025344.1 | Intron | XP_016880833.1 |
SMIM5 - small integral membrane protein 5 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001162995.2 | Intron | NP_001156467.1 | ||||
XM_011525116.2 | Intron | XP_011523418.1 | ||||
XM_011525118.2 | Intron | XP_011523420.1 | ||||
XM_011525119.2 | Intron | XP_011523421.1 | ||||
XM_017024943.1 | Intron | XP_016880432.1 | ||||
XM_017024944.1 | Intron | XP_016880433.1 | ||||
XM_017024945.1 | Intron | XP_016880434.1 | ||||
XM_017024946.1 | Intron | XP_016880435.1 | ||||
XM_017024947.1 | Intron | XP_016880436.1 | ||||
XM_017024948.1 | Intron | XP_016880437.1 |
SMIM6 - small integral membrane protein 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |