Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACATAAAACTCTTTAAGAACTCCTC[C/T]TGACTGGTGACTGTCAACACTTGAT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608186 MIM: 182307 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
EXOC3 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
EXOC3 - exocyst complex component 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_007277.4 | Intron | NP_009208.2 | ||||
XM_011513948.2 | Intron | XP_011512250.1 | ||||
XM_011513949.2 | Intron | XP_011512251.1 | ||||
XM_011513950.2 | Intron | XP_011512252.1 | ||||
XM_011513951.2 | Intron | XP_011512253.1 | ||||
XM_017009000.1 | Intron | XP_016864489.1 | ||||
XM_017009001.1 | Intron | XP_016864490.1 | ||||
XM_017009002.1 | Intron | XP_016864491.1 | ||||
XM_017009003.1 | Intron | XP_016864492.1 | ||||
XM_017009004.1 | Intron | XP_016864493.1 | ||||
XM_017009005.1 | Intron | XP_016864494.1 | ||||
XM_017009006.1 | Intron | XP_016864495.1 |
LOC100288152 - uncharacterized LOC100288152 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PP7080 - uncharacterized LOC25845 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SLC9A3 - solute carrier family 9 member A3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001284351.2 | Intron | NP_001271280.1 | ||||
NM_004174.3 | Intron | NP_004165.2 |
Set Membership: |
HapMap |