Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAATGAGACATGGGAGGGATAGGAT[C/T]GTTTCTTCTCCCACTCATAAACCTT
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 606239 MIM: 606887 | |||||||||||||||||||||||||||||||||||||||||
Literature Links: |
IKZF4 PubMed Links | |||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
IKZF4 - IKAROS family zinc finger 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_022465.3 | 235 | Intron | NP_071910.3 | |||
XM_005269086.3 | 235 | Intron | XP_005269143.1 | |||
XM_005269089.2 | 235 | UTR 5 | XP_005269146.1 | |||
XM_005269090.3 | 235 | Intron | XP_005269147.1 | |||
XM_005269093.2 | 235 | Intron | XP_005269150.1 | |||
XM_011538664.1 | 235 | Intron | XP_011536966.1 | |||
XM_011538666.2 | 235 | Intron | XP_011536968.1 | |||
XM_011538669.2 | 235 | Intron | XP_011536971.1 | |||
XM_017019805.1 | 235 | Intron | XP_016875294.1 | |||
XM_017019806.1 | 235 | Intron | XP_016875295.1 | |||
XM_017019807.1 | 235 | Intron | XP_016875296.1 | |||
XM_017019808.1 | 235 | Intron | XP_016875297.1 | |||
XM_017019809.1 | 235 | Intron | XP_016875298.1 | |||
XM_017019810.1 | 235 | Intron | XP_016875299.1 | |||
XM_017019811.1 | 235 | Intron | XP_016875300.1 | |||
XM_017019812.1 | 235 | Intron | XP_016875301.1 | |||
XM_017019813.1 | 235 | Intron | XP_016875302.1 | |||
XM_017019814.1 | 235 | Intron | XP_016875303.1 | |||
XM_017019815.1 | 235 | Intron | XP_016875304.1 | |||
XM_017019816.1 | 235 | Intron | XP_016875305.1 |
LOC105369781 - uncharacterized LOC105369781 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SUOX - sulfite oxidase | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |