Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGACAGCTGTCCCCATCCCAGCCCT[A/T]GCTTCCTCTACAAAAGCAACTGAAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600806 | ||||||||||||||||||||
Literature Links: |
CNN1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CNN1 - calponin 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ELOF1 - elongation factor 1 homolog | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032377.3 | 1111 | UTR 3 | NP_115753.1 | |||
XM_017027356.1 | 1111 | UTR 3 | XP_016882845.1 | |||
XM_017027357.1 | 1111 | UTR 3 | XP_016882846.1 | |||
XM_017027358.1 | 1111 | UTR 3 | XP_016882847.1 | |||
XM_017027359.1 | 1111 | UTR 3 | XP_016882848.1 |
LOC105369211 - uncharacterized LOC105369211 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |