Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACAGCCCACTGCACACCACCTGTCC[T/C]GAATGAGCCCCTGACGCCCCCTCCC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
26 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||||||||||||||||||||
Literature Links: |
FAM213B PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
FAM213B - family with sequence similarity 213 member B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001195736.1 | Intron | NP_001182665.1 | ||||
NM_001195737.1 | Intron | NP_001182666.1 | ||||
NM_001195738.1 | Intron | NP_001182667.1 | ||||
NM_001195740.1 | Intron | NP_001182669.1 | ||||
NM_001195741.1 | Intron | NP_001182670.1 | ||||
NM_152371.3 | Intron | NP_689584.2 | ||||
XM_006710354.3 | Intron | XP_006710417.1 | ||||
XM_011540664.1 | Intron | XP_011538966.1 | ||||
XM_011540665.1 | Intron | XP_011538967.1 | ||||
XM_011540666.1 | Intron | XP_011538968.1 |
LOC100996583 - uncharacterized LOC100996583 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MMEL1 - membrane metallo-endopeptidase-like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_033467.3 | Intron | NP_258428.2 | ||||
XM_011542122.2 | Intron | XP_011540424.1 | ||||
XM_017002310.1 | Intron | XP_016857799.1 | ||||
XM_017002311.1 | Intron | XP_016857800.1 | ||||
XM_017002312.1 | Intron | XP_016857801.1 | ||||
XM_017002313.1 | Intron | XP_016857802.1 | ||||
XM_017002314.1 | Intron | XP_016857803.1 | ||||
XM_017002315.1 | Intron | XP_016857804.1 |