Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTTCTTTTATCTGGAGATTTTGAAA[C/T]TTTACCAGATAACTATGTTTAAATA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
37 submissions
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608280 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
GAS5 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
Global
|
Caucasian
|
CEPH (CEU)
|
|||||||||
EAS
|
African American
|
YRI (Yoruba)
|
|||||||||
SAS
|
Japanese
|
JPT (Japanese)
|
|||||||||
AFR
|
Chinese
|
CHB (Han Chinese)
|
|||||||||
EUR
|
|||||||||||
AMR
|
GAS5 - growth arrest specific 5 (non-protein coding) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GAS5-AS1 - GAS5 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA103 - small nucleolar RNA, H/ACA box 103 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD44 - small nucleolar RNA, C/D box 44 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD47 - small nucleolar RNA, C/D box 47 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD74 - small nucleolar RNA, C/D box 74 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD75 - small nucleolar RNA, C/D box 75 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD76 - small nucleolar RNA, C/D box 76 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD77 - small nucleolar RNA, C/D box 77 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD78 - small nucleolar RNA, C/D box 78 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD79 - small nucleolar RNA, C/D box 79 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD80 - small nucleolar RNA, C/D box 80 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD81 - small nucleolar RNA, C/D box 81 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZBTB37 - zinc finger and BTB domain containing 37 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001122770.1 | Intron | NP_001116242.1 | ||||
NM_032522.3 | Intron | NP_115911.1 | ||||
XM_005245546.2 | Intron | XP_005245603.1 | ||||
XM_006711578.3 | Intron | XP_006711641.1 | ||||
XM_011510062.2 | Intron | XP_011508364.1 | ||||
XM_017002556.1 | Intron | XP_016858045.1 | ||||
XM_017002557.1 | Intron | XP_016858046.1 | ||||
XM_017002558.1 | Intron | XP_016858047.1 |
Set Membership: |
HapMap Validated |