Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGCAGATCATCTGTTCTGGTGGATG[C/T]ACGAAGCTGTGATATAAATGCCACT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607063 MIM: 608778 | ||||||||||||||||||||
Literature Links: |
FKBP10 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FKBP10 - FK506 binding protein 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KLHL10 - kelch like family member 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NT5C3B - 5'-nucleotidase, cytosolic IIIB | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_052935.4 | Intron | NP_443167.4 | ||||
XM_006721669.3 | Intron | XP_006721732.1 | ||||
XM_006721670.3 | Intron | XP_006721733.1 | ||||
XM_011524276.2 | Intron | XP_011522578.1 | ||||
XM_011524277.2 | Intron | XP_011522579.1 | ||||
XM_017024127.1 | Intron | XP_016879616.1 |