Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGGTAAAAGCAGGGGGCAAAGCGG[G/T]GGCCCTCCCTTTCTGGGGGTCACTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608503 | ||||||||||||||||||||
Literature Links: |
ABHD14A PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ABHD14A - abhydrolase domain containing 14A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ABHD14A-ACY1 - ABHD14A-ACY1 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ABHD14B - abhydrolase domain containing 14B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001146314.1 | 2086 | UTR 3 | NP_001139786.1 | |||
NM_001254753.1 | 2086 | UTR 3 | NP_001241682.1 | |||
NM_032750.2 | 2086 | UTR 3 | NP_116139.1 |
PCBP4 - poly(rC) binding protein 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |