Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGCGGCAAGATCGCATCTCCCGGCT[A/C]ATGGGCGACTATCTGCTGCGCGGTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616128 MIM: 606044 | ||||||||||||||||||||
Literature Links: |
EHBP1L1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EHBP1L1 - EH domain binding protein 1 like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM89B - family with sequence similarity 89 member B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SSSCA1 - Sjogren syndrome/scleroderma autoantigen 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001303024.1 | 237 | UTR 5 | NP_001289953.1 | |||
NM_006396.2 | 237 | Silent Mutation | CTA,CTC | L,L 37 | NP_006387.1 |
SSSCA1-AS1 - SSSCA1 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |