Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AACGCAGAAGAAAGCTGCTCAAGTG[A/C]TGGAGTGGCCAACCCCATGCCGTTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 608280 | ||||||||||||||||||||
Literature Links: |
GAS5 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GAS5 - growth arrest specific 5 (non-protein coding) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GAS5-AS1 - GAS5 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORA103 - small nucleolar RNA, H/ACA box 103 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD44 - small nucleolar RNA, C/D box 44 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD47 - small nucleolar RNA, C/D box 47 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD74 - small nucleolar RNA, C/D box 74 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD75 - small nucleolar RNA, C/D box 75 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD76 - small nucleolar RNA, C/D box 76 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD77 - small nucleolar RNA, C/D box 77 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD78 - small nucleolar RNA, C/D box 78 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD79 - small nucleolar RNA, C/D box 79 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD80 - small nucleolar RNA, C/D box 80 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD81 - small nucleolar RNA, C/D box 81 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZBTB37 - zinc finger and BTB domain containing 37 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001122770.1 | 72 | Intron | NP_001116242.1 | |||
NM_032522.3 | 72 | Intron | NP_115911.1 | |||
XM_005245546.2 | 72 | Intron | XP_005245603.1 | |||
XM_006711578.3 | 72 | Intron | XP_006711641.1 | |||
XM_011510062.2 | 72 | Intron | XP_011508364.1 | |||
XM_017002556.1 | 72 | UTR 5 | XP_016858045.1 | |||
XM_017002557.1 | 72 | Intron | XP_016858046.1 | |||
XM_017002558.1 | 72 | Intron | XP_016858047.1 |