Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGAAGGTGAGCCCACTAACCCCTGA[A/G]CCAGTCTATTCCATTGTGGACAACA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
70 submissions
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602600 MIM: 602603 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
LOC100507564 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
LOC100507564 - uncharacterized LOC100507564 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRP8 - LDL receptor related protein 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001018054.2 | Intron | NP_001018064.1 | ||||
NM_004631.4 | Intron | NP_004622.2 | ||||
NM_017522.4 | Intron | NP_059992.3 | ||||
NM_033300.3 | Intron | NP_150643.2 | ||||
XM_005271173.3 | Intron | XP_005271230.1 | ||||
XM_005271174.3 | Intron | XP_005271231.1 | ||||
XM_005271175.3 | Intron | XP_005271232.1 | ||||
XM_006710881.3 | Intron | XP_006710944.1 | ||||
XM_006710882.3 | Intron | XP_006710945.1 | ||||
XM_011542094.2 | Intron | XP_011540396.1 | ||||
XM_011542095.2 | Intron | XP_011540397.1 | ||||
XM_011542096.2 | Intron | XP_011540398.1 | ||||
XM_017002265.1 | Intron | XP_016857754.1 | ||||
XM_017002266.1 | Intron | XP_016857755.1 | ||||
XM_017002267.1 | Intron | XP_016857756.1 | ||||
XM_017002268.1 | Intron | XP_016857757.1 |
MAGOH - mago homolog, exon junction complex core component | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |