Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACTGGGGATATGAAATTGAAATCAG[C/G]CCTTTATTTTTAAAGAGAATGGCTA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608165 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
GULP1 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
GULP1 - GULP, engulfment adaptor PTB domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001252668.1 | Intron | NP_001239597.1 | ||||
NM_001252669.1 | Intron | NP_001239598.1 | ||||
NM_016315.3 | Intron | NP_057399.1 | ||||
XM_006712580.3 | Intron | XP_006712643.1 | ||||
XM_006712581.1 | Intron | XP_006712644.1 | ||||
XM_006712582.1 | Intron | XP_006712645.1 | ||||
XM_006712583.3 | Intron | XP_006712646.1 | ||||
XM_006712584.3 | Intron | XP_006712647.1 | ||||
XM_006712585.1 | Intron | XP_006712648.1 | ||||
XM_006712589.3 | Intron | XP_006712652.1 | ||||
XM_011511329.1 | Intron | XP_011509631.1 | ||||
XM_011511331.1 | Intron | XP_011509633.1 | ||||
XM_011511332.1 | Intron | XP_011509634.1 | ||||
XM_011511333.1 | Intron | XP_011509635.1 | ||||
XM_011511335.2 | Intron | XP_011509637.1 | ||||
XM_017004303.1 | Intron | XP_016859792.1 | ||||
XM_017004304.1 | Intron | XP_016859793.1 | ||||
XM_017004305.1 | Intron | XP_016859794.1 | ||||
XM_017004306.1 | Intron | XP_016859795.1 | ||||
XM_017004307.1 | Intron | XP_016859796.1 | ||||
XM_017004308.1 | Intron | XP_016859797.1 |
LINC01090 - long intergenic non-protein coding RNA 1090 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR561 - microRNA 561 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |