Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGCAGAGACAGCCTCGCCCCCACA[T/C]GGCGCCAGGCCCCACAGCTGCCACA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
7 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 612094 | ||||||||||||||||||||
Literature Links: |
MIR429 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR429 - microRNA 429 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TTLL10 - tubulin tyrosine ligase like 10 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001130045.1 | 100 | Intron | NP_001123517.1 | |||
NM_153254.2 | 100 | Intron | NP_694986.2 | |||
XM_005244738.1 | 100 | Intron | XP_005244795.1 | |||
XM_011541177.2 | 100 | Intron | XP_011539479.1 | |||
XM_017000906.1 | 100 | UTR 5 | XP_016856395.1 | |||
XM_017000907.1 | 100 | UTR 5 | XP_016856396.1 | |||
XM_017000908.1 | 100 | UTR 5 | XP_016856397.1 | |||
XM_017000909.1 | 100 | UTR 5 | XP_016856398.1 | |||
XM_017000910.1 | 100 | UTR 5 | XP_016856399.1 | |||
XM_017000911.1 | 100 | UTR 5 | XP_016856400.1 | |||
XM_017000912.1 | 100 | Intron | XP_016856401.1 |
TTLL10-AS1 - TTLL10 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |