Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCTTTGGGCCAGGCTGGTATGACC[G/T]TGGCAGGTTTGTGGTGCCTGGGATG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604323 MIM: 604065 | ||||||||||||||||||||
Literature Links: |
ABCC3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ABCC3 - ATP binding cassette subfamily C member 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001144070.1 | Intron | NP_001137542.1 | ||||
NM_003786.3 | Intron | NP_003777.2 | ||||
XM_005257763.3 | Intron | XP_005257820.1 | ||||
XM_011525422.2 | Intron | XP_011523724.1 | ||||
XM_011525423.1 | Intron | XP_011523725.1 | ||||
XM_011525424.2 | Intron | XP_011523726.1 | ||||
XM_011525425.2 | Intron | XP_011523727.1 | ||||
XM_017025265.1 | Intron | XP_016880754.1 | ||||
XM_017025266.1 | Intron | XP_016880755.1 |
CACNA1G - calcium voltage-gated channel subunit alpha1 G | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101927253 - uncharacterized LOC101927253 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |