Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGAGGTCAATTGCAAATGGAGGTG[A/G]GACCTGAGAAAACAAAGAAATGATT
Species: |
Human | |||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 112203 MIM: 615534 | |||||||||||||||||||||||||||||||||||
Literature Links: |
CD80 PubMed Links | |||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian
|
CEPH (CEU) - Not Available | ||||||
EAS - Not Available | African American
|
YRI (Yoruba) - Not Available | ||||||
SAS - Not Available | Japanese
|
CHB (Han Chinese) - Not Available | ||||||
AFR - Not Available | Chinese
|
JPT (Japanese) - Not Available | ||||||
EUR - Not Available | ||||||||
AMR - Not Available |
CD80 - CD80 molecule | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005191.3 | 3370 | UTR 3 | NP_005182.1 | |||
XM_011513327.2 | 3370 | UTR 3 | XP_011511629.1 | |||
XM_017007520.1 | 3370 | Intron | XP_016863009.1 |
TIMMDC1 - translocase of inner mitochondrial membrane domain containing 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
Validated |