Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCCAGGCAGGCAGGGAGGGAGAAAA[G/T]CCTAGCCCGGCGCCCTCGGCCACGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 107773 | ||||||||||||||||||||
Literature Links: |
MIR1469 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MIR1469 - microRNA 1469 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NR2F2 - nuclear receptor subfamily 2 group F member 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145155.1 | Intron | NP_001138627.1 | ||||
NM_001145156.1 | Intron | NP_001138628.1 | ||||
NM_001145157.1 | Intron | NP_001138629.1 | ||||
NM_021005.3 | Intron | NP_066285.1 |
NR2F2-AS1 - NR2F2 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |