Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTGCCAACAGTTTGATTCCACAGT[A/G]AATTTGAGAGCTCAGCCACCCGTGC
Species: |
Human | |||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
|||||||||||||||||||||||||||||||||||
Phenotype: |
||||||||||||||||||||||||||||||||||||
Literature Links: |
LRRC31 PubMed Links | |||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian
|
CEPH (CEU) - Not Available | ||||||
EAS - Not Available | African American
|
YRI (Yoruba) - Not Available | ||||||
SAS - Not Available | Japanese
|
CHB (Han Chinese) - Not Available | ||||||
AFR - Not Available | Chinese
|
JPT (Japanese) - Not Available | ||||||
EUR - Not Available | ||||||||
AMR - Not Available |
LRRC31 - leucine rich repeat containing 31 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001277127.1 | Intron | NP_001264056.1 | ||||
NM_001277128.1 | Intron | NP_001264057.1 | ||||
NM_024727.3 | Intron | NP_079003.2 | ||||
XM_011513158.2 | Intron | XP_011511460.1 | ||||
XM_011513159.2 | Intron | XP_011511461.1 | ||||
XM_011513160.2 | Intron | XP_011511462.1 | ||||
XM_017007204.1 | Intron | XP_016862693.1 |
LRRIQ4 - leucine rich repeats and IQ motif containing 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |